circad | circRNAs associated with diseases

MCF7_circ_000595
Gene	DYNC1H1	Organism	Human
Genome Locus	chr14:102466325-102500789:+	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	27829232
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Tumour and adjacent tissues and six breast cancer cell lines (BT20, BT474, MCF7, MDAMB468, T47D, and ZR751)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTACAGATATTGCCAGGACGG Reverse TCCTTCAGCCTACCAAACTTC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Nair, AA, Niu, N, Tang, X, Thompson, KJ, Wang, L, Kocher, JP, Subramanian, S, Kalari, KR (2016). Circular RNAs and their associations with breast cancer subtypes. Oncotarget, 7, 49:80967-80979.